MicroRNA Activity Is Suppressed in Mouse Oocytes
نویسندگان
چکیده
منابع مشابه
MicroRNA Activity Is Suppressed in Mouse Oocytes
MicroRNAs (miRNAs) are small endogenous RNAs that typically imperfectly base pair with 3' untranslated regions (3'UTRs) and mediate translational repression and mRNA degradation. Dicer, which generates small RNAs in the miRNA and RNA interference (RNAi) pathways, is essential for meiotic maturation of mouse oocytes. We found that 3'UTRs of transcripts upregulated in Dicer1(-/-) oocytes are not ...
متن کاملMicroRNA-27a activity is not suppressed in porcine oocytes.
MicroRNAs (miRNAs) are a class of small noncoding RNAs involved in multiple cellular processes. Recent findings indicate that miRNA activity is globally suppressed in mouse oocytes. However, whether miRNAs are expressed and function in porcine oocytes remains unknown. In this study, our aims were to ascertain if miRNA biogenesis occurs and whether miRNA activity is globally suppressed during po...
متن کاملSupplemental Information MicroRNA Function Is Globally Suppressed in Mouse Oocytes and Early Embryos
The Dgcr8 delta/flox mice were crossed to Zp3-Cre [1] mice and resulting offsprings were intercrossed to produce Dgcr8 ;Zp3-Cre animals. The following primers were used to genotype mice and the oocytes; P1 5’ primer, TTTCCAACCCAAGTCAGCAGAT ;P1 3’ primer, AGTGCATGTGCCATGCTGCCA; P2 5’ primer, CTGGAGTAGGCATGTTGATTTC; P2 3’ primer, CCTGATTCACTTACAACACAACC; P3 3’ primer, TAAAGCGTCCACATCATTGTC. To de...
متن کاملMicroRNA Function Is Globally Suppressed in Mouse Oocytes and Early Embryos
Dicer, which is required for the processing of both microRNAs (miRNAs) and small interfering RNAs (siRNAs), is essential for oocyte maturation [1, 2]. Oocytes express both miRNAs and endogenous siRNAs (endo-siRNAs) [3, 4]. To determine whether the abnormalities in Dicer knockout oocytes during meiotic maturation are secondary to the loss of endo-siRNAs and/or miRNAs, we deleted Dgcr8, which enc...
متن کاملActivity of hexokinase in mouse oocytes and preimplantation embryos
T h e I40 bp RurriH 1 S d l fragment was excised from pUC 19 : HP, gel purified and extracted from a 7.5% (w/v) acrylamide gel. It was then subcloned into the HurnH I Sull sites o f the polyliker in pUR 278 (Ruther & Muller-Hill, 1983) located at the ('terminus of P-galactosidasc. This resulted in the construct pUR278 : HP. After EcoRl linker addition, the same RurnH 1 -&I1 fragment from p U C ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Current Biology
سال: 2010
ISSN: 0960-9822
DOI: 10.1016/j.cub.2009.12.042