MicroRNA Activity Is Suppressed in Mouse Oocytes

نویسندگان
چکیده

برای دانلود باید عضویت طلایی داشته باشید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

MicroRNA Activity Is Suppressed in Mouse Oocytes

MicroRNAs (miRNAs) are small endogenous RNAs that typically imperfectly base pair with 3' untranslated regions (3'UTRs) and mediate translational repression and mRNA degradation. Dicer, which generates small RNAs in the miRNA and RNA interference (RNAi) pathways, is essential for meiotic maturation of mouse oocytes. We found that 3'UTRs of transcripts upregulated in Dicer1(-/-) oocytes are not ...

متن کامل

MicroRNA-27a activity is not suppressed in porcine oocytes.

MicroRNAs (miRNAs) are a class of small noncoding RNAs involved in multiple cellular processes. Recent findings indicate that miRNA activity is globally suppressed in mouse oocytes. However, whether miRNAs are expressed and function in porcine oocytes remains unknown. In this study, our aims were to ascertain if miRNA biogenesis occurs and whether miRNA activity is globally suppressed during po...

متن کامل

Supplemental Information MicroRNA Function Is Globally Suppressed in Mouse Oocytes and Early Embryos

The Dgcr8 delta/flox mice were crossed to Zp3-Cre [1] mice and resulting offsprings were intercrossed to produce Dgcr8 ;Zp3-Cre animals. The following primers were used to genotype mice and the oocytes; P1 5’ primer, TTTCCAACCCAAGTCAGCAGAT ;P1 3’ primer, AGTGCATGTGCCATGCTGCCA; P2 5’ primer, CTGGAGTAGGCATGTTGATTTC; P2 3’ primer, CCTGATTCACTTACAACACAACC; P3 3’ primer, TAAAGCGTCCACATCATTGTC. To de...

متن کامل

MicroRNA Function Is Globally Suppressed in Mouse Oocytes and Early Embryos

Dicer, which is required for the processing of both microRNAs (miRNAs) and small interfering RNAs (siRNAs), is essential for oocyte maturation [1, 2]. Oocytes express both miRNAs and endogenous siRNAs (endo-siRNAs) [3, 4]. To determine whether the abnormalities in Dicer knockout oocytes during meiotic maturation are secondary to the loss of endo-siRNAs and/or miRNAs, we deleted Dgcr8, which enc...

متن کامل

Activity of hexokinase in mouse oocytes and preimplantation embryos

T h e I40 bp RurriH 1 S d l fragment was excised from pUC 19 : HP, gel purified and extracted from a 7.5% (w/v) acrylamide gel. It was then subcloned into the HurnH I Sull sites o f the polyliker in pUR 278 (Ruther & Muller-Hill, 1983) located at the ('terminus of P-galactosidasc. This resulted in the construct pUR278 : HP. After EcoRl linker addition, the same RurnH 1 -&I1 fragment from p U C ...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Current Biology

سال: 2010

ISSN: 0960-9822

DOI: 10.1016/j.cub.2009.12.042